Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: Primer sequences used in this paper.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques:

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: Antibodies used in this paper.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques: Reverse Transcription

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: Human telomerase reverse transcriptase (hTERT) and NRF2 are highly expressed in CRC tissues and associated with poor diagnosis. (A) hTERT expression in CRC tissues and adjacent normal tissues was investigated in Oncomine database (Cohort1). (B) NRF2 expression in CRC tissues and adjacent normal tissues was investigated in Oncomine database (Cohort2). (C) hTERT mRNA expression in CRC tissues and paired adjacent normal tissues was identified by qRT-PCR (Cohort3). (D) NRF2 mRNA expression in CRC tissues and paired adjacent normal tissues was identified by qRT-PCR (Cohort3). (E) Regulation analysis of the correlation between hTERT and NRF2 (Cohort3). Each point represents one cancer sample. (F) Representative immunohistochemical staining and expression level statistics of hTERT and NRF2 in CRC tissues and paired adjacent normal tissues (Cohort4). (G) Regulation analysis of the correlation between hTERT and NRF2 (Cohort4). Each point represents one cancer sample. (H) Kaplan–Meier analysis of the overall survival of CRC patients with different hTERT expression levels ( p < 0.05, log-rank test). (I) Kaplan–Meier analysis of the overall survival of CRC patients with different NRF2 expression levels ( p < 0.05, log-rank test). (J) Kaplan–Meier analysis of the overall survival of CRC patients with different hTERT and NRF2 expression levels ( p < 0.05, log-rank test). * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001; ns, no significance.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques: Reverse Transcription, Biomarker Discovery, Expressing, Quantitative RT-PCR, Immunohistochemical staining, Staining

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: Human telomerase reverse transcriptase (hTERT) upregulates NRF2 expression by promoting NRF2 transcriptional activity. (A) hTERT-knockdown cells were constructed by transfecting sh1-hTERT and sh2-hTERT lenviral respectively into HCT 116 cells. The hTERT and NRF2 mRNA expression level after downregulation of hTERT were identified by qRT-PCR. (B) hTERT and NRF2 protein expression levels after downregulation of hTERT were detected by western blotting (Left). Statistical analysis of western blotting (Right). (C) hTERT-overexpressed cell was constructed by transfecting hTERT lenviral into SW620 cells. The hTERT and NRF2 mRNA expression level after upregulation of hTERT was identified by qRT-PCR. (D) hTERT and NRF2 protein expression levels after overexpression of hTERT were detected by western blotting (Left). Statistical analysis of western blotting (Right). (E) Luciferase activity of the NRF2 promoter was detected after downregulation of hTERT. (F) Luciferase activity of NRF2 was detected after overexpression of hTERT. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, no significance.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques: Reverse Transcription, Expressing, Activity Assay, Knockdown, Construct, Quantitative RT-PCR, Western Blot, Over Expression, Luciferase

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: Human telomerase reverse transcriptase (hTERT) promotes colorectal cancer cell proliferation and metastasis by upregulating NRF2. (A) CCK8 assays were performed to detect cell proliferation after downregulation of hTERT but an increase in NRF2 expression. (B) Colony formation assays were performed after downregulation of hTERT but an increase in NRF2 expression. (C) Statistical analysis of the colony numbers. (D) Migration and invasion assays were performed after downregulation of hTERT but an increase in NRF2 expression. (E) Statistical analysis of the migration cell numbers. (F) Statistical analysis of the invasion cell numbers. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, no significance.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques: Reverse Transcription, Expressing, Migration

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: Human telomerase reverse transcriptase (hTERT) increases NRF2 expression by recruiting YBX1 to bind to the NRF2 promoter. (A) Flow chart for screening of potential hTERT-recruited NRF2 transcription factors. (B) The YBX1 and NRF2 mRNA expression level was identified by qRT-PCR after downregulation of YBX1. (C) Luciferase activity of the NRF2 promoter was detected after downregulation of YBX1. (D) NRF2 promoter with a 5′ biotin label was used to pull-down YBX1. Mock beads were used as a negative control. (E) Diagrammatic drawing of NRF2 P2 fragment. The P2 fragment was divided into 5 fragments. (F) YBX1 antibody was used to immunoprecipitate binding fragments of the NRF2 promoter under the condition of hTERT overexpression and fragments were identified by ChIP-qPCR with six primers (Left). Statistical analysis of ChIP-qPCR. (G) Luciferase activity of P2 fragment containing different mutant sites was detected after YBX1 overexpression. (H) HCT116 cell lysates were prepared for separate IP with hTERT and YBX1 antibody and then evaluated via western blotting. (I) The subcellular localization and the colocalization of hTERT and YBX1 were examined in SW620 cells via dual immunofluorescence using confocal microscopy. (J) YBX1 in cell nuclei and cytoplasm was identified by western blotting after overexpression of Flag-hTERT. (K) The NRF2 mRNA expression level was identified by qRT-PCR after overexpression of hTERT and simultaneous knockdown of YBX1. (L) Luciferase activity of the NRF2 promoter was detected after overexpression of hTERT and simultaneous knockdown of YBX1. (M) The NRF2 protein level was identified by western blotting after overexpression of hTERT and simultaneous knockdown of YBX1 (Left). Statistical analysis of western blotting (Right). * p < 0.05; ** p < 0.01; *** p < 0.001; ns, no significance.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques: Reverse Transcription, Expressing, Quantitative RT-PCR, Luciferase, Activity Assay, Negative Control, Binding Assay, Over Expression, ChIP-qPCR, Mutagenesis, Western Blot, Immunofluorescence, Confocal Microscopy, Knockdown

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: YBX1 is responsible for upregulation of NRF2 expression and CRC proliferation and migration. (A) The YBX1 and NRF2 mRNA expression level were identified by qRT-PCR after downregulation of YBX1 and simultaneous overexpression of NRF2. (B) The YBX1 and NRF2 protein expression level were identified via western blotting after downregulation of YBX1 and simultaneous overexpression of NRF2 (Left). Statistical analysis of western blotting (Right). (C) CCK8 assays were performed to detect cell proliferation after downregulation of YBX1 but an increase in NRF2 expression. (D) Colony formation assays were performed after downregulation of YBX1 but an increase in NRF2 expression (Left). Statistical analysis of the colony numbers (Right). (E) Migration and invasion assays were performed after downregulation of YBX1 but an increase in NRF2 expression. (F) Statistical analysis of the migration cell numbers. (G) Statistical analysis of the invasion cell numbers. (H) The YBX1 and NRF2 mRNA expression level were identified by qRT-PCR after overexpression of YBX1 and simultaneous downregulation of NRF2. (I) The YBX1 and NRF2 protein expression level were identified via western blotting after overexpression of YBX1 and simultaneous downregulation of NRF2 (Left). Statistical analysis of western blotting (Right). (J) CCK8 assays were performed to detect cell proliferation after overexpression of YBX1 and downregulation of NRF2. (K) Colony formation assays were performed after overexpression of YBX1 and downregulation of NRF2 (Left). Statistical analysis of the colony numbers (Right). (L) Migration and invasion assays were performed after overexpression of YBX1 and downregulation of NRF2. (M) Statistical analysis of the migration cell numbers. (N) Statistical analysis of the invasion cell numbers. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, no significance.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques: Expressing, Migration, Quantitative RT-PCR, Over Expression, Western Blot

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: YBX1 is highly expressed in CRC and associated with poor prognosis. (A) YBX1 expression in CRC tissues and adjacent normal tissues was investigated in Oncomine database. (B) YBX1 mRNA expression in CRC tissues and paired adjacent normal tissues was identified by qRT-PCR. (C) Regulation analysis of the correlation between YBX1 and NRF2. Each point represents one cancer sample. (D) Representative immunohistochemical staining and expression level statistics of YBX1 in CRC tissues and paired adjacent normal tissues. (E) Regulation analysis of the correlation between YBX1 and NRF2. Each point represents one cancer sample. (F) Kaplan–Meier analysis of the overall survival of CRC patients with different YBX1 expression levels ( p < 0.05, log-rank test). (G) Kaplan–Meier analysis of the overall survival of CRC patients with different YBX1 and NRF2 expression levels ( p < 0.05, log-rank test). * p < 0.05;** p < 0.01; *** p < 0.001; **** p < 0.0001; ns, no significance.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques: Expressing, Quantitative RT-PCR, Immunohistochemical staining, Staining

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: Model for transcriptional regulation of NRF2 by hTERT via recruitment of YBX1 in CRC proliferation and migration. In this model, hTERT recruits YBX1 to form a transcriptional complex, which binds to the NRF2 promoter to promote NRF2 expression, thus promoting CRC proliferation and migration.

Article Snippet: The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads ® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway).

Techniques: Migration, Expressing

Journal: EMBO Reports

Article Title: NRF2 supports non-small cell lung cancer growth independently of CBP/p300-enhanced glutathione synthesis

doi: 10.1038/s44319-025-00463-z

Figure Lengend Snippet: ( A ) Alignment of metazoan NRF2 Neh4 and Neh5 segments with Neh4/5mut substitutions indicated. Mutation of QD in Neh5 was derived from (Zhang et al, ). ( B ) Western blot of input (left) and FLAG-immunoprecipitations (right) of FLAG-tagged WT, Neh4/5mut, ΔNeh1, or luciferase control expressing HEK293 cells co-transfected with or without GFP-tagged CBP. Data are representative of three independent experiments. ( C ) Western blotting of H460-shNRF2-BIND-luc, -BIND-WT NRF2, -BIND-Neh4/5mut, or -BIND-ΔNeh1 cells treated with water (control) or 2.5 ng/mL dox for 24 h probing with FLAG, NRF2, or β-actin antibodies. Representative data from three independent experiments is shown. ( D ) Crystal violet staining of H460-shNRF2-BIND-luc, -BIND-WT NRF2, -BIND-Neh4/5mut, or -BIND-ΔNeh1 treated with water (control) or 2.5 ng/mL dox for 8 days. Representative data from three independent experiments is shown. ( E ) CellTiter-Glo measurements of H460-shNRF2-BIND-luc, -BIND-WT NRF2, -BIND-Neh4/5mut, or -BIND-ΔNeh1 treated with water (control) or 2.5 ng/mL dox for 5 days. Data are expressed as a fold of control values, with SD indicated and are derived from three individual experiments. ( F ) Quantification of scratch assay wound healing in A549shNRF2-BIND cells +/−2.5 ng/mL dox imaged over 7 days on the Incucyte system. Wound healing rate is shown as the ratio of the scratch area at day 7 vs day 0, with a ratio of 1 representing no migration of cells into the scratch area. Data are derived from three individual replicates.

Article Snippet: EF1ɑ-/TRE3G-promoter-driven Renilla luciferase and NRF2 (WT NRF2, Neh4/5mut, SV40-NLS-ΔNeh1) constructs , GenScript/this work , N/A.

Techniques: Mutagenesis, Derivative Assay, Western Blot, Luciferase, Control, Expressing, Transfection, Staining, Wound Healing Assay, Migration

Journal: EMBO Reports

Article Title: NRF2 supports non-small cell lung cancer growth independently of CBP/p300-enhanced glutathione synthesis

doi: 10.1038/s44319-025-00463-z

Figure Lengend Snippet: ( A ) Domain structure of NRF2 indicating point mutations in the Neh4/5mut protein. ( B , C ) FLAG IP/MS on nuclear fractions from A549 cells expressing Renilla luciferase, WT NRF2, or Neh4/5mut proteins. Differential enrichment between WT NRF2 vs Renilla luciferase ( B ) and Neh4/5mut vs WT NRF2 ( C ) are shown. Data are derived from four individual replicates. ( D ) qRT-PCR from RNA isolated from A549-shNRF2-BIND-luc, -BIND-WT NRF2, -BIND-Neh4/5mut, or -BIND-ΔNeh1 cells treated with water (control) or 2.5 ng/mL dox for 24 h using indicated primers normalized to RPL13A as a housekeeping gene. Exogenous NRF2 constructs are codon optimized and thus not detected by NFE2L2 primer. Data are generated in triplicate with mean +/− SD shown. Representative data from three independent experiments is shown. ( E ) Western blot of cells from ( D ) probing with FLAG, NRF2, or β-actin antibodies. Representative data from three independent experiments is shown. ( F ) Correlation of transcriptomic changes induced by rescue with WT NRF2 vs. Neh4/5mut in A549-shNRF2-BIND-WT NRF2 and -BIND-Neh4/5mut cells after 24 h of dox (2.5 ng/mL) treatment. Values show limma-voom log 2 fold changes between 24 and 0 h of treatment for each NRF2 construct, normalized by subtracting the log 2 fold change between 24 and 0 h of Luciferase. Highlighted points are NRF2 signature genes colored by cosine similarity between WT and Neh4/5mut. Cosine values of 1 represent the same angle and hence no differential expression between Neh4/5mut and WT NRF2, with more divergence as values decrease. ( G ) Western blot of cells from A549-shNRF2-BIND-luc, -BIND-WT NRF2 or -BIND-Neh4/5mut cells treated with water (control) or 2.5 ng/mL dox for 48 h, probing for FLAG, NRF2, H2B, SQSTM1, GCLC, NR0B1, and TXNRD1 antibodies. Representative data from three independent experiments is shown. .

Article Snippet: EF1ɑ-/TRE3G-promoter-driven Renilla luciferase and NRF2 (WT NRF2, Neh4/5mut, SV40-NLS-ΔNeh1) constructs , GenScript/this work , N/A.

Techniques: Protein-Protein interactions, Expressing, Luciferase, Derivative Assay, Quantitative RT-PCR, Isolation, Control, Construct, Generated, Western Blot, Quantitative Proteomics

Journal: EMBO Reports

Article Title: NRF2 supports non-small cell lung cancer growth independently of CBP/p300-enhanced glutathione synthesis

doi: 10.1038/s44319-025-00463-z

Figure Lengend Snippet: ( A ) Incucyte growth curves of A549-shNRF2-BIND-luc, -BIND-WT NRF2, -BIND-Neh4/5mut, or -BIND-ΔNeh1 cells treated with water (control) or 2.5 ng/mL dox. Representative data from two independent experiments is shown, with mean and SEM derived from 16 images/well indicated. ( B ) Crystal violet staining of A549-shNRF2-BIND-luc, -BIND-WT NRF2, -BIND-Neh4/5mut, or -BIND-ΔNeh1 cells treated with water (control) or 2.5 ng/mL dox for 8 days. Representative data from three independent experiments is shown. ( C ) Correlation between A-485 mean viability and NRF2 dependency as defined by NFE2L2 Chronos score. NRF2 activation score, defined as the average RPKM of NRF2 target genes, is overlaid. Line represents linear regression between mean viability and NRF2 Chronos. ( D ) NRF2 activation score vs GEMINI Score (Zamanighomi et al, ) for co-knockout of CREBBP and EP300 . GEMINI scores represent the added effect of a gene pair interaction, with a score of zero indicating no additional effect beyond each gene’s individual contribution. .

Article Snippet: EF1ɑ-/TRE3G-promoter-driven Renilla luciferase and NRF2 (WT NRF2, Neh4/5mut, SV40-NLS-ΔNeh1) constructs , GenScript/this work , N/A.

Techniques: Control, Derivative Assay, Staining, Activation Assay, Knock-Out

Journal: Antioxidants

Article Title: Medicarpin Increases Antioxidant Genes by Inducing NRF2 Transcriptional Level in HeLa Cells

doi: 10.3390/antiox11020421

Figure Lengend Snippet: Primer sets for real-time PCR.

Article Snippet: Human NRF2 promoter-luciferase reporter plasmid was constructed by inserting the amplified ~2 Kb sized NRF2 promoter into the modified pGL4.10-Basic vector (Promega, Madison, WI, USA), which contains AscI and PacI restriction enzyme sites in the multicloning sites.

Techniques:

Journal: Antioxidants

Article Title: Medicarpin Increases Antioxidant Genes by Inducing NRF2 Transcriptional Level in HeLa Cells

doi: 10.3390/antiox11020421

Figure Lengend Snippet: Medicarpin increases nuclear NRF2 accumulation, which results in HO-1 induction in HeLa cells. ( A ). Western blotting data shows nuclear NRF2 level after treatment with different concentrations of medicarpin for 6 h. The densitometrical analysis of nuclear NRF2 is shown in the right panel. ( B ). Western blot analysis using whole cell lysates shows the HO-1 level after treatment with the indicated concentration of medicarpin for 24 h. The densitometrical analysis of HO-1 is shown in the right panel. GAPDH and Lamin A/C were used as cytoplasmic and nuclear markers, respectively. CE, cytoplasmic extract; NE, nuclear extract. The experiments were repeated three times with similar results. ** p < 0.001; *** p < 0.0001.

Article Snippet: Human NRF2 promoter-luciferase reporter plasmid was constructed by inserting the amplified ~2 Kb sized NRF2 promoter into the modified pGL4.10-Basic vector (Promega, Madison, WI, USA), which contains AscI and PacI restriction enzyme sites in the multicloning sites.

Techniques: Western Blot, Concentration Assay

Journal: Antioxidants

Article Title: Medicarpin Increases Antioxidant Genes by Inducing NRF2 Transcriptional Level in HeLa Cells

doi: 10.3390/antiox11020421

Figure Lengend Snippet: Medicarpin induces the transcriptional level of NRF2 and NRF2 target genes in HeLa cells. A. Real-time PCR analysis showed the mRNA levels of NRF2, HO-1, GCLC, and NQO-1 after treatment with different concentrations of medicarpin for 24 h in HeLa cells. Experiments were performed in triplicate. * p < 0.05; ** p < 0.001; *** p < 0.0001; NS, not significant.

Article Snippet: Human NRF2 promoter-luciferase reporter plasmid was constructed by inserting the amplified ~2 Kb sized NRF2 promoter into the modified pGL4.10-Basic vector (Promega, Madison, WI, USA), which contains AscI and PacI restriction enzyme sites in the multicloning sites.

Techniques: Real-time Polymerase Chain Reaction

Journal: Antioxidants

Article Title: Medicarpin Increases Antioxidant Genes by Inducing NRF2 Transcriptional Level in HeLa Cells

doi: 10.3390/antiox11020421

Figure Lengend Snippet: Medicarpin induces the NRF2 transcriptional level in Hela cells. Cells were treated with 50 μM of medicarpin for 6 h in the condition of transfection with an NRF2-promoter luciferase construct. NRF2-luciferase activity was measured using a Dual-Luciferase Reporter Assay kit (Promega) according to the manufacturer’s instructions. Experiments were performed in quintuplicate. *** p < 0.0001.

Article Snippet: Human NRF2 promoter-luciferase reporter plasmid was constructed by inserting the amplified ~2 Kb sized NRF2 promoter into the modified pGL4.10-Basic vector (Promega, Madison, WI, USA), which contains AscI and PacI restriction enzyme sites in the multicloning sites.

Techniques: Transfection, Luciferase, Construct, Activity Assay, Reporter Assay

Journal: Antioxidants

Article Title: Medicarpin Increases Antioxidant Genes by Inducing NRF2 Transcriptional Level in HeLa Cells

doi: 10.3390/antiox11020421

Figure Lengend Snippet: Medicarpin increases the NRF2 stability by inhibiting ubiquitin-mediated proteolysis in HeLa cells. ( A ). Cells were treated with 50 μM of medicarpin for 6 h after co-transfection with pEGFP-NRF2 and pcDNA3.1-His ubiquitin plasmids. Next, cells were lysed with RIPA and His-ubiquitinated proteins were purified using Ni-NTA agarose beads. After washing with RIPA, ubiquitinylated eGFP-NRF2 was visualized by Western blot analysis. ( B ). The relative fold change of ubiquitinylated eGFP-NRF2 was measured using a densitometer from ( A ). Experiments were performed in duplicate.

Article Snippet: Human NRF2 promoter-luciferase reporter plasmid was constructed by inserting the amplified ~2 Kb sized NRF2 promoter into the modified pGL4.10-Basic vector (Promega, Madison, WI, USA), which contains AscI and PacI restriction enzyme sites in the multicloning sites.

Techniques: Cotransfection, Purification, Western Blot

Journal: Frontiers in Cell and Developmental Biology

Article Title: hTERT Promotes CRC Proliferation and Migration by Recruiting YBX1 to Increase NRF2 Expression

doi: 10.3389/fcell.2021.658101

Figure Lengend Snippet: Primer sequences used in this paper.

Article Snippet: NRF2 promoter-F , 5′ TTCTGCCGGTCTTGCTTACAGT 3′ , PCR , Sangon Biotech, Shanghai, China.

Techniques:

Journal: The Journal of Clinical Investigation

Article Title: AGER1 downregulation associates with fibrosis in nonalcoholic steatohepatitis and type 2 diabetes

doi: 10.1172/JCI133051

Figure Lengend Snippet: (A) WT mice were fed a HiAD for 14 weeks. At week 7, a group of mice were injected with AAV8-TBG-Nrf2 (5 × 1011 GC/mouse) or AAV8-GFP as a control. There was a decrease in serum and liver AGEs in the AAV8-Nrf2–injected group. (B) Expression of Ager1 and the NRF2 targets Gstp1 and Hmox1 increased following AAV8-Nrf2 injection. (C) Expression of transcripts reflecting inflammation — Mcp1, Tnfa, and Il1b — was also significantly reduced. (D) Expression of Col1a1 and Tgfb was significantly decreased by Nrf2 transduction. Data are presented as the mean ± SEM. *P < 0.05, **P < 0.01, and ***P < 0.001, by 1-way ANOVA with Tukey’s post hoc test.

Article Snippet: A group of control ( fl/fl) mice fed a high-AGE diet were injected with 5 × 10 11 genome copies (GC) AAV8 thyroxine-binding globulin (TBG) promoter- Nrf2 or control GFP (Vector Biolabs) via the tail vein at 7 weeks and were then euthanized 7 weeks after injection (14 weeks on the diet).

Techniques: Injection, Expressing, Transduction

Journal: Antioxidants & Redox Signaling

Article Title: Reductive Stress Causes Pathological Cardiac Remodeling and Diastolic Dysfunction

doi: 10.1089/ars.2019.7808

Figure Lengend Snippet: Constitutive activation of Nrf2 induces chronic reductive stress in TG mouse hearts. (A) The nuclear Nrf2 levels in the heart were determined by IB in NTG and caNrf2 TGL and TGH mice (n = 3). Raw images (uncut) are represented in Supplementary Fig. S5. (B) The Nrf2 and Nrf2-ARE binding activities were measured in three mouse groups at 6–8 months of age (n = 6) using nuclear extracts. Results are presented as fold-change compared with the NTG group. (C) Myocardial levels of glutathione (GSH) and the ratio of its reduced/oxidized form (GSH/GSSG) were determined by enzyme kinetic assays. In parallel, tissue concentrations of cysteine (Cys) and cysteine-GSH adduct (CySSG) were quantified by an HPLC-based fluorometric assay among the three mouse groups at 6–8 months of age (n = 5/group). Data are represented as mean ± SEM. Significance: *p < 0.05; **p < 0.01; ***p < 0.001; ns, no significance. ARE, antioxidant response element; caNrf2, constitutive activation of nuclear erythroid-related factor-2; HPLC, high-performance liquid chromatography; IB, immunoblotting; NTG, nontransgenic; SEM, standard error of the mean; TG, transgenic; TGH, transgenic high; TGL, transgenic high.

Article Snippet: The Trans-AM Nrf2 promoter binding assay kit (50296) was from Active Motif (Carlsbad, CA).

Techniques: Activation Assay, Binding Assay, High Performance Liquid Chromatography, Western Blot, Transgenic Assay

Journal: Antioxidants & Redox Signaling

Article Title: Reductive Stress Causes Pathological Cardiac Remodeling and Diastolic Dysfunction

doi: 10.1089/ars.2019.7808

Figure Lengend Snippet: Correlation between redox status and functional changes indicated a cRS condition induces pathologic cardiac remodeling. Correlations among redox status (dose and time dependent) and cardiac functional outcomes (systolic and diastolic) are demonstrated in both young (2, 3, and 6 months) and old (15 months) TGL, TGH, and DTG mice, indicating remarkable impacts of cRS on both (A) systolic (i.e., EF%) and (B) diastolic (i.e., M/V E/A ratio) functions. (C) The diastolic function was deteriorating to increase reductive potential, whereas systolic function was elevated, suggesting that (D) varying degrees of reductive-redox through dose- and time-dependent Nrf2 expression influence on the structural and functional phenotypes of heart. (E) A schematic overview of how the caNrf2 expression induces cRS and depletes biological ROS signals, as well as how cRS (>6 months) induces the cardiac structural and functional remodeling by promoting cardiac hypertrophy and diastolic dysfunction. Doubling the myocardial Nrf2 levels (in DTG) further advances RS and accelerates cardiac remodeling/diastolic dysfunction as early as 1.8 months of age. Pharmacologic depletion of glutathione using BSO abolishes RS-mediated myocardial remodeling. cRS, chronic reductive stress; ROS, reactive oxygen species. Color images are available online.

Article Snippet: The Trans-AM Nrf2 promoter binding assay kit (50296) was from Active Motif (Carlsbad, CA).

Techniques: Functional Assay, Expressing

Journal: Antioxidants & Redox Signaling

Article Title: Reductive Stress Causes Pathological Cardiac Remodeling and Diastolic Dysfunction

doi: 10.1089/ars.2019.7808

Figure Lengend Snippet: Complete List of Primary Antibodies and Sources

Article Snippet: The Trans-AM Nrf2 promoter binding assay kit (50296) was from Active Motif (Carlsbad, CA).

Techniques: